Review



sgrna oligonucleotide sequences  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Addgene inc sgrna oligonucleotide sequences
    Sgrna Oligonucleotide Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 39 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+oligonucleotide+sequences/sgRNA+AAVS1+(Plasmid+%23128119)/pmc12209948__BLOODA_ADV-2024-014965-mmc1-10-22-21
    Average 94 stars, based on 39 article reviews
    sgrna oligonucleotide sequences - by Bioz Stars, 2026-11
    94/100 stars

    Images

    Related Articles

    CRISPR:

    Article Title: Mis-splicing of Mitotic Regulators Sensitizes SF3B1-Mutated Human HSCs to CHK1 Inhibition
    Article Snippet: Images were collected with an EVOS M5000 microscope (ThermoFisher Scientific). .. Lentiviral Vectors and Preparation For lentivirus-mediated CRISPR/Cas9 editing, oligos were cloned into pLentiCRISPR-v2-mCherry vector (#99154; a gift from Agata Smogorzewska) following the cloning vector protocol (Addgene). sgRNA oligonucleotide sequences are as follows: AAVS1 5′–GGGCCACTAGGGACAGGAT–3′ RUNX1#A 5′–CACTTCGACCGACAAACCTG–3′ RUNX1#C 5′–GAGCCCAGGCAAGATGAGCG–3′ STAG2#C 5′–AATACTAACCTTGAACCGAC–3′ Control Luciferase (M1) 5′–CTTACGCTGAGTACTTCGAC–3′ BUBR1#2 (B2) 5′–GAGACAACTAAACTGCAAATT–3′ BUBR1#3 (B3) 5′–GTGGAACACTGAAACTGTATG–3′ CDC27#2 (C2) 5′–CAAGTACCTAATCATAGTTTA–3′ CDC27#3 (C3) 5′–GCCTATAACAGTGACTTGATT–3′ GEN1#1 (G1) 5′–GCCTTTAAAGGAACGAATATT–3′ GEN1#2 (G2) 5′–CAATACTTCTGTCCCTTATTC–3′ AAVS1 5′–GGGCCACUAGGGACAGGAU–3′ CHK1 5′–AACCUCAAAAUCUCAGACUU–3′ were purified on a BD FACS Aria III sorter. ..

    Article Title: Distinct routes of clonal progression in SF3B1-mutant myelodysplastic syndromes
    Article Snippet: .. For lentivirus-mediated CRISPR/Cas9 editing, oligos were cloned into pLentiCRISPR-v2-mCherry vector (#99154; a gift from Agata Smogorzewska) following the cloning vector protocol (Addgene). sgRNA oligonucleotide sequences are as follows: AAVS1 5’ – GGGCCACTAGGGACAGGAT – 3’ RUNX1#C (exon 4, NM_001754) 5’ – GAGCCCAGGCAAGATGAGCG – 3’ STAG2#B (exon 16, NM_001042749) 5’ – ATACCTTGTGGATAGCATGT – 3’ Virus was prepared using third generation packaging plasmids pMDLg/RRE, pRSV/Rev, and pMD.G for VSV-G pseudotyping. .. Plasmids were transfected into HEK 293T cells with calcium phosphate (Takara).

    Clone Assay:

    Article Title: Mis-splicing of Mitotic Regulators Sensitizes SF3B1-Mutated Human HSCs to CHK1 Inhibition
    Article Snippet: Images were collected with an EVOS M5000 microscope (ThermoFisher Scientific). .. Lentiviral Vectors and Preparation For lentivirus-mediated CRISPR/Cas9 editing, oligos were cloned into pLentiCRISPR-v2-mCherry vector (#99154; a gift from Agata Smogorzewska) following the cloning vector protocol (Addgene). sgRNA oligonucleotide sequences are as follows: AAVS1 5′–GGGCCACTAGGGACAGGAT–3′ RUNX1#A 5′–CACTTCGACCGACAAACCTG–3′ RUNX1#C 5′–GAGCCCAGGCAAGATGAGCG–3′ STAG2#C 5′–AATACTAACCTTGAACCGAC–3′ Control Luciferase (M1) 5′–CTTACGCTGAGTACTTCGAC–3′ BUBR1#2 (B2) 5′–GAGACAACTAAACTGCAAATT–3′ BUBR1#3 (B3) 5′–GTGGAACACTGAAACTGTATG–3′ CDC27#2 (C2) 5′–CAAGTACCTAATCATAGTTTA–3′ CDC27#3 (C3) 5′–GCCTATAACAGTGACTTGATT–3′ GEN1#1 (G1) 5′–GCCTTTAAAGGAACGAATATT–3′ GEN1#2 (G2) 5′–CAATACTTCTGTCCCTTATTC–3′ AAVS1 5′–GGGCCACUAGGGACAGGAU–3′ CHK1 5′–AACCUCAAAAUCUCAGACUU–3′ were purified on a BD FACS Aria III sorter. ..

    Article Title: Distinct routes of clonal progression in SF3B1-mutant myelodysplastic syndromes
    Article Snippet: .. For lentivirus-mediated CRISPR/Cas9 editing, oligos were cloned into pLentiCRISPR-v2-mCherry vector (#99154; a gift from Agata Smogorzewska) following the cloning vector protocol (Addgene). sgRNA oligonucleotide sequences are as follows: AAVS1 5’ – GGGCCACTAGGGACAGGAT – 3’ RUNX1#C (exon 4, NM_001754) 5’ – GAGCCCAGGCAAGATGAGCG – 3’ STAG2#B (exon 16, NM_001042749) 5’ – ATACCTTGTGGATAGCATGT – 3’ Virus was prepared using third generation packaging plasmids pMDLg/RRE, pRSV/Rev, and pMD.G for VSV-G pseudotyping. .. Plasmids were transfected into HEK 293T cells with calcium phosphate (Takara).

    Plasmid Preparation:

    Article Title: Mis-splicing of Mitotic Regulators Sensitizes SF3B1-Mutated Human HSCs to CHK1 Inhibition
    Article Snippet: Images were collected with an EVOS M5000 microscope (ThermoFisher Scientific). .. Lentiviral Vectors and Preparation For lentivirus-mediated CRISPR/Cas9 editing, oligos were cloned into pLentiCRISPR-v2-mCherry vector (#99154; a gift from Agata Smogorzewska) following the cloning vector protocol (Addgene). sgRNA oligonucleotide sequences are as follows: AAVS1 5′–GGGCCACTAGGGACAGGAT–3′ RUNX1#A 5′–CACTTCGACCGACAAACCTG–3′ RUNX1#C 5′–GAGCCCAGGCAAGATGAGCG–3′ STAG2#C 5′–AATACTAACCTTGAACCGAC–3′ Control Luciferase (M1) 5′–CTTACGCTGAGTACTTCGAC–3′ BUBR1#2 (B2) 5′–GAGACAACTAAACTGCAAATT–3′ BUBR1#3 (B3) 5′–GTGGAACACTGAAACTGTATG–3′ CDC27#2 (C2) 5′–CAAGTACCTAATCATAGTTTA–3′ CDC27#3 (C3) 5′–GCCTATAACAGTGACTTGATT–3′ GEN1#1 (G1) 5′–GCCTTTAAAGGAACGAATATT–3′ GEN1#2 (G2) 5′–CAATACTTCTGTCCCTTATTC–3′ AAVS1 5′–GGGCCACUAGGGACAGGAU–3′ CHK1 5′–AACCUCAAAAUCUCAGACUU–3′ were purified on a BD FACS Aria III sorter. ..

    Article Title: Distinct routes of clonal progression in SF3B1-mutant myelodysplastic syndromes
    Article Snippet: .. For lentivirus-mediated CRISPR/Cas9 editing, oligos were cloned into pLentiCRISPR-v2-mCherry vector (#99154; a gift from Agata Smogorzewska) following the cloning vector protocol (Addgene). sgRNA oligonucleotide sequences are as follows: AAVS1 5’ – GGGCCACTAGGGACAGGAT – 3’ RUNX1#C (exon 4, NM_001754) 5’ – GAGCCCAGGCAAGATGAGCG – 3’ STAG2#B (exon 16, NM_001042749) 5’ – ATACCTTGTGGATAGCATGT – 3’ Virus was prepared using third generation packaging plasmids pMDLg/RRE, pRSV/Rev, and pMD.G for VSV-G pseudotyping. .. Plasmids were transfected into HEK 293T cells with calcium phosphate (Takara).

    Cloning:

    Article Title: Mis-splicing of Mitotic Regulators Sensitizes SF3B1-Mutated Human HSCs to CHK1 Inhibition
    Article Snippet: Images were collected with an EVOS M5000 microscope (ThermoFisher Scientific). .. Lentiviral Vectors and Preparation For lentivirus-mediated CRISPR/Cas9 editing, oligos were cloned into pLentiCRISPR-v2-mCherry vector (#99154; a gift from Agata Smogorzewska) following the cloning vector protocol (Addgene). sgRNA oligonucleotide sequences are as follows: AAVS1 5′–GGGCCACTAGGGACAGGAT–3′ RUNX1#A 5′–CACTTCGACCGACAAACCTG–3′ RUNX1#C 5′–GAGCCCAGGCAAGATGAGCG–3′ STAG2#C 5′–AATACTAACCTTGAACCGAC–3′ Control Luciferase (M1) 5′–CTTACGCTGAGTACTTCGAC–3′ BUBR1#2 (B2) 5′–GAGACAACTAAACTGCAAATT–3′ BUBR1#3 (B3) 5′–GTGGAACACTGAAACTGTATG–3′ CDC27#2 (C2) 5′–CAAGTACCTAATCATAGTTTA–3′ CDC27#3 (C3) 5′–GCCTATAACAGTGACTTGATT–3′ GEN1#1 (G1) 5′–GCCTTTAAAGGAACGAATATT–3′ GEN1#2 (G2) 5′–CAATACTTCTGTCCCTTATTC–3′ AAVS1 5′–GGGCCACUAGGGACAGGAU–3′ CHK1 5′–AACCUCAAAAUCUCAGACUU–3′ were purified on a BD FACS Aria III sorter. ..

    Article Title: Distinct routes of clonal progression in SF3B1-mutant myelodysplastic syndromes
    Article Snippet: .. For lentivirus-mediated CRISPR/Cas9 editing, oligos were cloned into pLentiCRISPR-v2-mCherry vector (#99154; a gift from Agata Smogorzewska) following the cloning vector protocol (Addgene). sgRNA oligonucleotide sequences are as follows: AAVS1 5’ – GGGCCACTAGGGACAGGAT – 3’ RUNX1#C (exon 4, NM_001754) 5’ – GAGCCCAGGCAAGATGAGCG – 3’ STAG2#B (exon 16, NM_001042749) 5’ – ATACCTTGTGGATAGCATGT – 3’ Virus was prepared using third generation packaging plasmids pMDLg/RRE, pRSV/Rev, and pMD.G for VSV-G pseudotyping. .. Plasmids were transfected into HEK 293T cells with calcium phosphate (Takara).

    Control:

    Article Title: Mis-splicing of Mitotic Regulators Sensitizes SF3B1-Mutated Human HSCs to CHK1 Inhibition
    Article Snippet: Images were collected with an EVOS M5000 microscope (ThermoFisher Scientific). .. Lentiviral Vectors and Preparation For lentivirus-mediated CRISPR/Cas9 editing, oligos were cloned into pLentiCRISPR-v2-mCherry vector (#99154; a gift from Agata Smogorzewska) following the cloning vector protocol (Addgene). sgRNA oligonucleotide sequences are as follows: AAVS1 5′–GGGCCACTAGGGACAGGAT–3′ RUNX1#A 5′–CACTTCGACCGACAAACCTG–3′ RUNX1#C 5′–GAGCCCAGGCAAGATGAGCG–3′ STAG2#C 5′–AATACTAACCTTGAACCGAC–3′ Control Luciferase (M1) 5′–CTTACGCTGAGTACTTCGAC–3′ BUBR1#2 (B2) 5′–GAGACAACTAAACTGCAAATT–3′ BUBR1#3 (B3) 5′–GTGGAACACTGAAACTGTATG–3′ CDC27#2 (C2) 5′–CAAGTACCTAATCATAGTTTA–3′ CDC27#3 (C3) 5′–GCCTATAACAGTGACTTGATT–3′ GEN1#1 (G1) 5′–GCCTTTAAAGGAACGAATATT–3′ GEN1#2 (G2) 5′–CAATACTTCTGTCCCTTATTC–3′ AAVS1 5′–GGGCCACUAGGGACAGGAU–3′ CHK1 5′–AACCUCAAAAUCUCAGACUU–3′ were purified on a BD FACS Aria III sorter. ..

    Luciferase:

    Article Title: Mis-splicing of Mitotic Regulators Sensitizes SF3B1-Mutated Human HSCs to CHK1 Inhibition
    Article Snippet: Images were collected with an EVOS M5000 microscope (ThermoFisher Scientific). .. Lentiviral Vectors and Preparation For lentivirus-mediated CRISPR/Cas9 editing, oligos were cloned into pLentiCRISPR-v2-mCherry vector (#99154; a gift from Agata Smogorzewska) following the cloning vector protocol (Addgene). sgRNA oligonucleotide sequences are as follows: AAVS1 5′–GGGCCACTAGGGACAGGAT–3′ RUNX1#A 5′–CACTTCGACCGACAAACCTG–3′ RUNX1#C 5′–GAGCCCAGGCAAGATGAGCG–3′ STAG2#C 5′–AATACTAACCTTGAACCGAC–3′ Control Luciferase (M1) 5′–CTTACGCTGAGTACTTCGAC–3′ BUBR1#2 (B2) 5′–GAGACAACTAAACTGCAAATT–3′ BUBR1#3 (B3) 5′–GTGGAACACTGAAACTGTATG–3′ CDC27#2 (C2) 5′–CAAGTACCTAATCATAGTTTA–3′ CDC27#3 (C3) 5′–GCCTATAACAGTGACTTGATT–3′ GEN1#1 (G1) 5′–GCCTTTAAAGGAACGAATATT–3′ GEN1#2 (G2) 5′–CAATACTTCTGTCCCTTATTC–3′ AAVS1 5′–GGGCCACUAGGGACAGGAU–3′ CHK1 5′–AACCUCAAAAUCUCAGACUU–3′ were purified on a BD FACS Aria III sorter. ..

    Purification:

    Article Title: Mis-splicing of Mitotic Regulators Sensitizes SF3B1-Mutated Human HSCs to CHK1 Inhibition
    Article Snippet: Images were collected with an EVOS M5000 microscope (ThermoFisher Scientific). .. Lentiviral Vectors and Preparation For lentivirus-mediated CRISPR/Cas9 editing, oligos were cloned into pLentiCRISPR-v2-mCherry vector (#99154; a gift from Agata Smogorzewska) following the cloning vector protocol (Addgene). sgRNA oligonucleotide sequences are as follows: AAVS1 5′–GGGCCACTAGGGACAGGAT–3′ RUNX1#A 5′–CACTTCGACCGACAAACCTG–3′ RUNX1#C 5′–GAGCCCAGGCAAGATGAGCG–3′ STAG2#C 5′–AATACTAACCTTGAACCGAC–3′ Control Luciferase (M1) 5′–CTTACGCTGAGTACTTCGAC–3′ BUBR1#2 (B2) 5′–GAGACAACTAAACTGCAAATT–3′ BUBR1#3 (B3) 5′–GTGGAACACTGAAACTGTATG–3′ CDC27#2 (C2) 5′–CAAGTACCTAATCATAGTTTA–3′ CDC27#3 (C3) 5′–GCCTATAACAGTGACTTGATT–3′ GEN1#1 (G1) 5′–GCCTTTAAAGGAACGAATATT–3′ GEN1#2 (G2) 5′–CAATACTTCTGTCCCTTATTC–3′ AAVS1 5′–GGGCCACUAGGGACAGGAU–3′ CHK1 5′–AACCUCAAAAUCUCAGACUU–3′ were purified on a BD FACS Aria III sorter. ..

    FACS:

    Article Title: Mis-splicing of Mitotic Regulators Sensitizes SF3B1-Mutated Human HSCs to CHK1 Inhibition
    Article Snippet: Images were collected with an EVOS M5000 microscope (ThermoFisher Scientific). .. Lentiviral Vectors and Preparation For lentivirus-mediated CRISPR/Cas9 editing, oligos were cloned into pLentiCRISPR-v2-mCherry vector (#99154; a gift from Agata Smogorzewska) following the cloning vector protocol (Addgene). sgRNA oligonucleotide sequences are as follows: AAVS1 5′–GGGCCACTAGGGACAGGAT–3′ RUNX1#A 5′–CACTTCGACCGACAAACCTG–3′ RUNX1#C 5′–GAGCCCAGGCAAGATGAGCG–3′ STAG2#C 5′–AATACTAACCTTGAACCGAC–3′ Control Luciferase (M1) 5′–CTTACGCTGAGTACTTCGAC–3′ BUBR1#2 (B2) 5′–GAGACAACTAAACTGCAAATT–3′ BUBR1#3 (B3) 5′–GTGGAACACTGAAACTGTATG–3′ CDC27#2 (C2) 5′–CAAGTACCTAATCATAGTTTA–3′ CDC27#3 (C3) 5′–GCCTATAACAGTGACTTGATT–3′ GEN1#1 (G1) 5′–GCCTTTAAAGGAACGAATATT–3′ GEN1#2 (G2) 5′–CAATACTTCTGTCCCTTATTC–3′ AAVS1 5′–GGGCCACUAGGGACAGGAU–3′ CHK1 5′–AACCUCAAAAUCUCAGACUU–3′ were purified on a BD FACS Aria III sorter. ..

    Virus:

    Article Title: Distinct routes of clonal progression in SF3B1-mutant myelodysplastic syndromes
    Article Snippet: .. For lentivirus-mediated CRISPR/Cas9 editing, oligos were cloned into pLentiCRISPR-v2-mCherry vector (#99154; a gift from Agata Smogorzewska) following the cloning vector protocol (Addgene). sgRNA oligonucleotide sequences are as follows: AAVS1 5’ – GGGCCACTAGGGACAGGAT – 3’ RUNX1#C (exon 4, NM_001754) 5’ – GAGCCCAGGCAAGATGAGCG – 3’ STAG2#B (exon 16, NM_001042749) 5’ – ATACCTTGTGGATAGCATGT – 3’ Virus was prepared using third generation packaging plasmids pMDLg/RRE, pRSV/Rev, and pMD.G for VSV-G pseudotyping. .. Plasmids were transfected into HEK 293T cells with calcium phosphate (Takara).



    Similar Products

    acc 554 oligonucleotides sgrna sequence  (DSMZ)
    97
    DSMZ acc 554 oligonucleotides sgrna sequence
    Acc 554 Oligonucleotides Sgrna Sequence, supplied by DSMZ, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+oligonucleotide+sequences/MOLM-13/pm41411133-275-185-181
    Average 97 stars, based on 1 article reviews
    acc 554 oligonucleotides sgrna sequence - by Bioz Stars, 2026-11
    97/100 stars
    		  Buy from Supplier
    cell lines k562 atcc ccl 243 hek293t atcc crl 3216 oligonucleotides sgrna sequence  (ATCC)
    99
    ATCC cell lines k562 atcc ccl 243 hek293t atcc crl 3216 oligonucleotides sgrna sequence
    Cell Lines K562 Atcc Ccl 243 Hek293t Atcc Crl 3216 Oligonucleotides Sgrna Sequence, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+oligonucleotide+sequences/293T/pm41014566-33-310-313
    Average 99 stars, based on 1 article reviews
    cell lines k562 atcc ccl 243 hek293t atcc crl 3216 oligonucleotides sgrna sequence - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    oligonucleotides bearing an sgrna sequence  (Benchling Inc)
    90
    Benchling Inc oligonucleotides bearing an sgrna sequence
    Oligonucleotides Bearing An Sgrna Sequence, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+oligonucleotide+sequences/single+guide+rnas/med_rxiv__2025__07__17__25331211-68-11-5
    Average 90 stars, based on 1 article reviews
    oligonucleotides bearing an sgrna sequence - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    sgrna oligonucleotide sequences  (Addgene inc)
    94
    Addgene inc sgrna oligonucleotide sequences
    Sgrna Oligonucleotide Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+oligonucleotide+sequences/sgRNA+AAVS1+(Plasmid+%23128119)/pmc12209948__BLOODA_ADV-2024-014965-mmc1-10-22-21
    Average 94 stars, based on 1 article reviews
    sgrna oligonucleotide sequences - by Bioz Stars, 2026-11
    94/100 stars
    		  Buy from Supplier
    oligonucleotides carrying sgrna sequences  (New England Biolabs)
    96
    New England Biolabs oligonucleotides carrying sgrna sequences
    Oligonucleotides Carrying Sgrna Sequences, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+oligonucleotide+sequences/BlpI/pmc10901463__NIHMS1964433___supplement___Supplementary_Material-40-2-12
    Average 96 stars, based on 1 article reviews
    oligonucleotides carrying sgrna sequences - by Bioz Stars, 2026-11
    96/100 stars
    		  Buy from Supplier
    oligonucleotides encoding the sgrna sequences  (Twist Bioscience)
    90
    Twist Bioscience oligonucleotides encoding the sgrna sequences
    Oligonucleotides Encoding The Sgrna Sequences, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+oligonucleotide+sequences/sgrna+sequences/pm40138428-213-0-8
    Average 90 stars, based on 1 article reviews
    oligonucleotides encoding the sgrna sequences - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    oligonucleotides containing these sgrna sequences  (Cosmo Genetech Co)
    90
    Cosmo Genetech Co oligonucleotides containing these sgrna sequences
    Oligonucleotides Containing These Sgrna Sequences, supplied by Cosmo Genetech Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+oligonucleotide+sequences/oligonucleotides+containing+each+sgrna+sequence/pm40033380-220-0-8
    Average 90 stars, based on 1 article reviews
    oligonucleotides containing these sgrna sequences - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    oligonucleotides with sgrna sequences  (CustomArray Inc)
    90
    CustomArray Inc oligonucleotides with sgrna sequences
    Oligonucleotides With Sgrna Sequences, supplied by CustomArray Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+oligonucleotide+sequences/oligonucleotides+for+sgrnas/pm39915607-57-2-10
    Average 90 stars, based on 1 article reviews
    oligonucleotides with sgrna sequences - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    oligonucleotides for the sgrna sequence of trbc1 and trbc2 genes  (Addgene inc)
    90
    Addgene inc oligonucleotides for the sgrna sequence of trbc1 and trbc2 genes
    Oligonucleotides For The Sgrna Sequence Of Trbc1 And Trbc2 Genes, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+oligonucleotide+sequences/oligonucleotides+for+the+sgrna+sequence+of+trbc1+and+trbc2+genes/pmc11684821__jci___135___181895___s065-176-0-33
    Average 90 stars, based on 1 article reviews
    oligonucleotides for the sgrna sequence of trbc1 and trbc2 genes - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    pa02c atcc n a pa03c atcc n a fadu atcc n a kyse 30 unc tissue culture facility n a oligonucleotides sgrna sequences  (ATCC)
    97
    ATCC pa02c atcc n a pa03c atcc n a fadu atcc n a kyse 30 unc tissue culture facility n a oligonucleotides sgrna sequences
    Pa02c Atcc N A Pa03c Atcc N A Fadu Atcc N A Kyse 30 Unc Tissue Culture Facility N A Oligonucleotides Sgrna Sequences, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+oligonucleotide+sequences/FaDu/pm39708320-278-0-1
    Average 97 stars, based on 1 article reviews
    pa02c atcc n a pa03c atcc n a fadu atcc n a kyse 30 unc tissue culture facility n a oligonucleotides sgrna sequences - by Bioz Stars, 2026-11
    97/100 stars
    		  Buy from Supplier

    Image Search Results